Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

438-GST
(Plasmid #97092)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 97092 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFastBac
  • Backbone size (bp) 6130
  • Vector type
    Insect Expression
  • Promoter Polyhedrin promoter
  • Selectable markers
    Gentamicin
  • Tags / Fusion Proteins
    • GST tag (N terminal on backbone)
    • TEV cleavage site (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GST 3' F (5' ACTTCATGTTGTATGACGCTC 3')
  • 3′ sequencing primer LicBac dual V1 Rv (5'-caggttcagggggaggtgtg-3')
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated.

438-GST has a TEV cleavable GST at the N-terminus. MBP can improve expression and solubility of the target protein. The 438-GST vector use the LICv1 Forward and Reverse primers.

LICv1Forward - 5'-TACTTCCAATCCAATGCA-3'
LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3'

As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul.

For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    438-GST was a gift from Chris Jeans (Addgene plasmid # 97092 ; http://n2t.net/addgene:97092 ; RRID:Addgene_97092)