pBa-LSS-GFP-LDLR wt
(Plasmid #98184)

• Purpose: Low Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.
• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Jenkins et al J Cell Biol. 2012 Aug 20;198(4):749-61. doi: 10.1083/jcb.201205070.

Backbone

• Vector backbone: pBa-eGFP
• Backbone size w/o insert (bp): 6755
• Total vector size (bp): 9335
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LDLR
• Alt name: human low density lipoprotein receptor
• Species: H. sapiens (human)
• Insert Size (bp): 3326
• Mutation: none
• GenBank ID: NM_000527
• Entrez Gene: LDLR (a.k.a. FH, FHC, FHCL1, LDLCQ2)
• Promoter: Chicken Beta Actin
• Tags / Fusion Proteins:
  • GFP (N terminal on insert)
  • LDLR signal sequence, N-term of GFP so GFP remains on mature protein when ss is cleaved (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII-vector, NheI-insert (destroyed during cloning)
• 3′ cloning site: RsrII (not destroyed)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry