pCML 314
(Plasmid #98584)

• Purpose: pCsrA-NYFP + CsrB-2MS2BD. Expresses protein-NYFP and RNA-2MS2BD fusions in E. coli for TriFC assay (ampR).
• Depositing Lab: Lydia Contreras
• Publication: Gelderman et al Biotechnol Bioeng. 2015 Feb;112(2):365-75. doi: 10.1002/bit.25351. Epub 2014 Sep 26.

Backbone

• Vector backbone: Derived from pDMSA-Y1 (Kostecki et al., 2010, 10.1371/journal.pone.0009225)
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 4000
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: May need to be grown at room temperature for complementation assay.
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: CsrA
• Species: Escherichia Coli K-12 MG1655
• Insert Size (bp): 183
• GenBank ID:
• Promoter: pLacO

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: N/A
• 3′ sequencing primer: CCGTTTACGTCGCCGTCCAGCTCGACCAGG

Gene/Insert 2

• Gene/Insert name: csrB
• Species: Escherichia coli K-12 MG1655
• Insert Size (bp): 330
• Promoter: pLacO

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: N/A
• 3′ sequencing primer: CCTTAGGATCCATATATAGGGCCC

Resource Information

• Supplemental Documents:
  • pCML_314.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry