This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCML 314
(Plasmid #98584)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98584 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Derived from pDMSA-Y1 (Kostecki et al., 2010, 10.1371/journal.pone.0009225)
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 4000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    May need to be grown at room temperature for complementation assay.
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    CsrA
  • Species
    Escherichia Coli K-12 MG1655
  • Insert Size (bp)
    183
  • GenBank ID
  • Promoter pLacO

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer N/A
  • 3′ sequencing primer CCGTTTACGTCGCCGTCCAGCTCGACCAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    csrB
  • Species
    Escherichia coli K-12 MG1655
  • Insert Size (bp)
    330
  • Promoter pLacO

Cloning Information for Gene/Insert 2

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCML 314 was a gift from Lydia Contreras (Addgene plasmid # 98584 ; http://n2t.net/addgene:98584 ; RRID:Addgene_98584)
  • For your References section:

    Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria. Gelderman G, Sivakumar A, Lipp S, Contreras L. Biotechnol Bioeng. 2015 Feb;112(2):365-75. doi: 10.1002/bit.25351. Epub 2014 Sep 26. 10.1002/bit.25351 PubMed 25080893