pCML 221
(Plasmid
#98587)
-
PurposepMS2-CYFP. Expresses MS2 protein-CYFP fusion in E. coli for TriFC assay (kanR).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneDerived from pDMSD-Y2 (Kostecki et al., 2010, 10.1371/journal.pone.0009225)
- Backbone size w/o insert (bp) 3100
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMay need to be grown at room temperature for complementation assay.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2
- Promoter pLacO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer GTTATATCGATTTACAGATCTTCTTCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCML 221 was a gift from Lydia Contreras (Addgene plasmid # 98587 ; http://n2t.net/addgene:98587 ; RRID:Addgene_98587) -
For your References section:
Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria. Gelderman G, Sivakumar A, Lipp S, Contreras L. Biotechnol Bioeng. 2015 Feb;112(2):365-75. doi: 10.1002/bit.25351. Epub 2014 Sep 26. 10.1002/bit.25351 PubMed 25080893