pCAG-OSF-VPS15
(Plasmid
#99326)
-
PurposeComponent for mammalian expression of recombinant PI3KC3-C1 complex
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99326 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS15
-
SpeciesH. sapiens (human)
-
GenBank IDAAI27106.1
-
Entrez GenePIK3R4 (a.k.a. VPS15, p150)
- Promoter CMV
-
Tag
/ Fusion Protein
- Strep-Strep-Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer pCAG_fwd: 5'- TTC CTCGATCGACGGTATCGA
- 3′ sequencing primer pCAG_rev: 5'- gagccagggcattggccacac
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Strep-Strep-Flag-VPS15-stop, codon-optimized gene
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-OSF-VPS15 was a gift from James Hurley (Addgene plasmid # 99326 ; http://n2t.net/addgene:99326 ; RRID:Addgene_99326) -
For your References section:
Architecture and dynamics of the autophagic phosphatidylinositol 3-kinase complex. Baskaran S, Carlson LA, Stjepanovic G, Young LN, Kim DJ, Grob P, Stanley RE, Nogales E, Hurley JH. Elife. 2014 Dec 9;3. doi: 10.7554/eLife.05115. 10.7554/eLife.05115 PubMed 25490155