Skip to main content

lenti-EF1a-dCas9-KRAB-Puro
(Plasmid #99372)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99372 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9192
  • Total vector size (bp) 14337
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin, Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-KRAB-T2A-Puro
  • Species
    synthetic; S. pyogenes
  • Insert Size (bp)
    5145
  • Promoter EF-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCas9: Addgene plasmid #61425 (Feng Zhang lab) KRAB: Addgene plasmid #50919 (Rene Maehr, Scot Wolfe lab)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

dCas9 sequence is from Addgene plasmid #61425 (generously shared by Feng Zhang lab). "Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.", Konermann et al.. 2014

KRAB sequence is from Addgene plasmid #50919 (generously shared by Rene Maehr, Scot Wolfe lab). "Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.", Kearns et al. 2014

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-EF1a-dCas9-KRAB-Puro was a gift from Kristen Brennand (Addgene plasmid # 99372 ; http://n2t.net/addgene:99372 ; RRID:Addgene_99372)
  • For your References section:

    Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I, Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 10.1016/j.stemcr.2017.06.012 PubMed 28757163