Systematic analysis of the molecular and biophysical properties of key DNA damage response factors.
Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC
Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. PubMed Article
Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC
Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. PubMed Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 207078 | Halo-SHLD2 HRD | Homologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus. |
| 207080 | RNF168-Halo HRD | Homologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF168 locus. |
| 207081 | Rif1-Halo HRD | Homologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RIF1 locus. |
| 207083 | RNF169-Halo HRD | Homologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF169 locus. |
| 207089 | ATM N-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus. |
| 207090 | MDC1 N-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus. |
| 207091 | 53BP1 N-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus. |
| 207092 | NBS1 C-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus. |
| 207094 | SHLD3 N-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus. |
| 207097 | ATM C-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus. |
| 207098 | SHLD2 N-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus. |
| 207099 | RNF169 C-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus. |
| 207101 | SHLD1 N-terminal sgRNA | pX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus. |
| 207102 | HaloTag KO sgRNA | pX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence. |
| 207103 | MDC1 KO sgRNA | pX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence. |
| 207104 | 53BP1 KO sgRNA | pX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence. |
| 207105 | SHLD3 KO sgRNA #1 | pX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus.. |
| 207106 | SHLD3 KO sgRNA #2 | pX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus.. |
| 207109 | Halo-MDC1 PST deletion | pHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the PST repeat region in human cells. |
| 207110 | Halo-MDC1 BRCT domain deletion | pHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the BRCT domain in human cells. |