Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: gWIZ
Information
- Source/Vendor
- Genlantis
- Alt Name
- gWiz-blank
- Plasmid Type
- Mammalian Expression
- Promoter
- Modified CMV
- Expression Level
- Unknown
- Cloning Method
- Restriction Enzyme
- Size
- 5063
- 5' Sequencing 1 Primer
- pMRB101-F - aagatgcaggcagctgagtt
- 3' Sequencing 1 Primer
- pXCX-F - ACAACAGATGGCTGGCAAC
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral