This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.
Addgene's website will be down due to scheduled maintenance starting at 8:00 PM EDT on Thursday, March 23, 2017. The website will resume normal function after an hour's time.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

reference_icon_book.jpg Sequencing Primers

Addgene uses a number of primers for sequence verification of deposited plasmids. Below is a list of primers currently in use. This list is available for your convenience, and will be updated as needed.

For reference information, please consult Addgene's Molecular Biology Reference Page.

All listed primers are 5′ to 3′.

Commonly Used Primers

Human CMV immediate early promoter, forward primer
Human U6 promoter, forward primer
5' end of luciferase, reverse primer
In lacZ gene
Murine stem cell virus, forward primer
Psi packaging signal, 5' of MCS in pBABE vectors, forward primer
3' end of glutathione-S-transferase, forward primer
SP6 promoter, forward primer
T3 promoter, forward primer
T7 promoter, forward primer

Full Primer List

For Pichia vectors with AOX1 terminator, reverse primer
For Pichia vectors with AOX1 promoter, forward primer
CaMV 35S promoter, forward primer
Drosophila Actin 5C promoter, forward primer
Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen)
Alpha factor signal sequence, forward primer
5' end of ampicillin resistance gene, reverse primer
For Pichia vectors with AUG1 promoter, forward primer
For Pichia vectors with AUG1 promoter, reverse primer
Bovine growth hormone terminator, reverse primer
Rabbit beta-globin intron, forward primer
Rabbit beta-globin intron, reverse primer
Rabbit beta-globin polyA region, reverse primer
5' end of chloramphenicol resistance gene, reverse primer
Human CMV immediate early promoter, forward primer
5' end of Cre recombinase, reverse primer
CYC1 transcription termination signal, reverse primer
3' end of DsRed1, forward primer
5' end of DsRed1, reverse primer
SV40 polyA terminator, reverse primer
Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen)
Drosophila heat shock promoter, forward primer
Human elongation factor-1a promoter, forward primer
3' end of EGFP, forward primer
5' end of EGFP, reverse primer
For distinguishing EGFP vs ECFP vs EYFP, reverse primer
F1 origin, forward primer
S. cerevisiae GAL1 promoter, forward primer
S. cerevisiae GAL10 promoter, forward primer
3' end of Gal4 DNA binding domain, forward primer
3' end of Gal4 activation domain, forward primer
3' end of GFP, forward primer
5' end of GFP, reverse primer
S. cerevisiae GPD promoter, forward primer
3' end of Gateway cassette, forward primer
5' end of Gateway cassette, reverse primer
Human H1 promoter, forward primer
HA tag, forward primer
HA tag, reverse primer
Histidine affinity tag, forward primer
Human growth hormone terminator, reverse primer
hrGFP (humanized Renilla GFP), forward primer
Human Ubiquitin C (UbC) promoter, forward primer
3' end of IRES, forward primer
5' end of IRES, reverse primer
5' of MCS in L4440 vector, forward primer
5' end of LacI, reverse primer
5' end of LacZ, reverse primer
3' end of LexA DNA binding domain, forward primer
Human U6 promoter, forward primer
Human CMV promoter, forward primer
3' end of luciferase, forward primer
5' end of luciferase, reverse primer
In lacZ gene
In lacZ gene
In lacZ gene
In lacZ gene
In lacZ gene
3' end of maltose binding protein, forward primer
3' end of mCherry, forward primer
5' end of mCherry, reverse primer
Drosophila metallothionein promoter, forward primer
Moloney murine leukemia virus LTR (MoMuLV), forward primer
Mouse PGK promoter, forward primer
Murine stem cell virus, forward primer
Murine stem cell virus, reverse primer
Mouse metallothionein 1 promoter, forward primer
Mouse U6 promoter, forward primer
Myc tag, forward primer
3' end of neomycin resistance gene, forward primer
5' end of neomycin resistance gene, reverse primer
Nopaline synthase promoter, forward primer
S. pombe nmt1 promoter, forward primer
OpIE2 promoter, forward primer
p15A origin, forward primer
For cloning sites after SalI in pAd-CMV vector
SV40 enhancer, 3' of MCS in pBABE vectors, reverse primer
Psi packaging signal, 5' of MCS in pBABE vectors, forward primer
For vectors with E. coli araBAD promoter, forward primer
For vectors with E. coli araBAD promoter, reverse primer
For pBluescript vector
For pBluescript vector
MMLV sequence, for inserts in pBMN retroviral vector
pBRS322 origin, forward primer
In pBR322 tet region, upstream of BamHI, forward primer
In pBR322, upsteam of EcoRI site, forward primer
In pBR322 tet region, downstream of BamHI, reverse primer
Rabbit beta-globin intron, for pCAG plasmids, forward primer
pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab)
5' end of Drosophila mini-white gene, reverse primer
Drosophila Hsp70 promoter, forward primer
5' of EcoRI site in pcDL vector, forward primer
5' of attL1 in pENTR vector, forward primer
3' of attL2 in pENTR vector, reverse primer
3' of MCS in pGEX vectors, reverse primer
3' end of glutathione-S-transferase, forward primer
R6K gamma origin, 3' of MCS in pGP704 vector, reverse primer
ADH terminator, reverse primer
Lambda phage early leftward (pL) promoter, forward primer
Murine stem cell virus, same as MSCV, forward primer
HCMV major immediate-early protein (IE), forward primer
3' end of synthetic intron, forward primer
MMLV sequence, 5' of MCS in pMXs vector, forward primer
Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen)
Polyhedrin promoter, forward primer
Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen)
For baculovirus vector with polyhedrin promoter, reverse primer
5' of MCS in pQE vectors, forward primer
Rous sarcoma virus (RSV) promoter, forward primer
To sequence yeast selectable marker in pRS vectors
PZ P-element, reverse primer
pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen)
5' of MCS in pTrcHis vector, forward primer
pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen)
3' of MCS in pTrcHis vector, same as pBAD-R, reverse primer
3' end of puromycin resistance gene, forward primer
Murine leukemia virus (MuLV), reverse primer
3' of Rous sarcoma virus (RSV) env gene, forward primer
3' end of Renilla luciferase, forward primer
5' of MCS in pGL3 vector, forward primer
Spleen focus forming virus 5' LTR, forward primer
SP6 promoter, forward primer
SV40 polyA, reverse primer
SV40 promoter/origin, forward primer
SV40 splice sequence, reverse primer
T3 promoter, forward primer
T7 promoter, forward primer
T7 terminator, reverse primer
Tac promoter, forward primer
3' end of tdTomato, forward primer
5' end of tdTomato, reverse primer
5' end of tetracycline resistance gene, reverse primer
Thymidine kinase polyA, reverse primer
Bacterial transposon Tn7
Human U6 promoter, forward primer
Drosophila Ultrabithorax gene, forward primer
V5 epitope, reverse primer
5' end of WPRE, reverse primer
Xenopus beta-globin 3'UTR, reverse primer
Xenopus EF1 alpha enhancer/promoter, forward primer
Xpress Forward TATGGCTAGCATGACTGGT (Invitrogen)
Xpress epitope, forward primer