|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Pamela J. Bjorkman > Sprague et al > pAcUW51-CgE
Plasmid 13762: pAcUW51-CgE
Gene/insert name: HSV-1 glycoprotein E
Alternative names: HSV-1 gE
Insert size (bp): 552
Species of gene(s): Herpes simplex virus type I KOS strain
Relevant mutations/deletions: C-terminal region of the HSV-1 gE (KOS strain ectodomain) was cloned downstream of the HSV-1 leader peptide by modifying Thr22 to Ala to create an AscI site to fuse the DNA encoding residues 213-390 in frame.
Fusion proteins or tags: His
Terminal: C terminal on insert
Vector backbone: pAcUW51
(Search Vector Database)
Backbone manufacturer: BD Biosciences
Type of vector: Insect expression
Backbone size (bp): 5863
Cloning site 5': AscI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: CGGACCTTTAATTCAACCCAAC  (List of Sequencing Primers)
3' Sequencing primer: TTGACACCAGACCAACTGGT
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:DH5a
Principal Investigator:Pamela J. Bjorkman
Terms and Licenses:MTA

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Click on map to enlarge

Article: Crystal structure of the HSV-1 Fc receptor bound to Fc reveals a mechanism for antibody bipolar bridging. Sprague ER et al. (PLoS Biol. 2006 Jun . 4(6):e148. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 13762" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved