1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pcDNA3.1(+)/myc-His A

Source/Vendor: Invitrogen
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Clone Method: Unknown
Size: 5493
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag 1: 6X His, myc
Bacterial Resistance: Ampicillin
Selectable Marker: Neomycin
Catalog Number: V80020
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map