Plasmid: pcDNA3.1/His B
| Source/Vendor: | Invitrogen |
|---|---|
| Alt Name: | pcDNA 3.1 His B |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Promotor: | CMV |
| Expression Level: | High |
| Clone Method: | Unknown |
| Size: | 5515 |
| 5' Sequencing 1 Primer: | T7 Fwd |
| 5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3' |
| Tag 1: | His |
| Bacterial Resistance: | Ampicillin |
| Selectable Marker: | Neomycin |
| Notes: | The sequence and map shown are from pcDNA3.1 His B. Please visit Invitrogen's website to find information on the related vectors. |
| Catalog Number: | V38520 |
| Stable: | Transient |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |