Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pcDNA3.1/Hygro(-)

This vector is NOT available from Addgene.

This page is informational only.

Please contact the manufacturer for further details.

Source/Vendor: Invitrogen
Alt Name: pcDNA 3.1 Hygro(-), pcDNA™3.1/Hygro(-)
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Cloning Method: Unknown
Size: 5596
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Bacterial Resistance: Ampicillin
Selectable Marker: Hygromycin
Differs from other pcDNA3.1 in drug resistance; +/- refers to orientation of f1 ori. Mammalian expression vector with the CMV promoter. The MCS is in the reverse (-) orientation.
Catalog Number: V875-20
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map
