1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pd2ECFP-1

Source/Vendor: Clontech
Plasmid Type: Mammalian Expression
Promotor: none
Clone Method: Unknown
Size: 4300
5' Sequencing 1 Primer: EGFP-N
5' Sequencing 1 Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'
Bacterial Resistance: Kanamycin
Selectable Marker: Neomycin
Notes:
Cyan variant of GFP. Used to monitor transcription from cis-regulatory elements
Catalog Number: 6910-1
Stable: Stable
Constitutive: Minimal or No Promoter
Viral/Non-Viral: Nonviral