Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pDEST17 Gateway

Source/Vendor: Invitrogen
Analyze: Sequence
Plasmid Type: Bacterial Expression
Promotor: n/a
Expression Level: Tightly controlled (use w/ BL21-AI)
Clone Method: Unknown
Size: 6300
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag 1: 6X His (Nterm)
Bacterial Resistance: Ampicillin
Easy to clone into other vectors
Catalog Number: 11803012
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map