Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pDsRed2-N1

This vector is NOT available from Addgene.

This page is informational only.

Please contact the manufacturer for further details.

Source/Vendor: Clontech
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Cloning Method: Unknown
Size: 4700
5' Sequencing 1 Primer: DsRed
5' Sequencing 1 Primer Sequence: 5'd[GTACTGGAACTGGGGGGACAG]
Tag 1: DsRed2 (Cterm)
Bacterial Resistance: Kanamycin
Selectable Marker: Neomycin
Red fluorescent protein tag
Catalog Number: 632406
Stable: Stable
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map
