Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pEF4/His C

This vector is NOT available from Addgene.

This page is informational only.

Please contact the manufacturer for further details.

Source/Vendor: Invitrogen
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: EF-1a
Expression Level: High
Cloning Method: Unknown
Size: 5773
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag 1: 6X His, Xpress
Bacterial Resistance: Ampicillin
Selectable Marker: Zeocin
Easy to clone into other vectors.
Catalog Number: V94320
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map
