Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pEGFP-1
Source/Vendor: | Clontech |
Analyze: | Sequence |
Plasmid Type: | Mammalian Expression |
Promotor: | none |
Cloning Method: | Unknown |
Size: | 4200 |
5' Sequencing 1 Primer: | EGFP-N |
5' Sequencing 1 Primer Sequence: | 5'd[CGTCGCCGTCCAGCTCGACCAG]3' |
Bacterial Resistance: | Kanamycin |
Selectable Marker: | Neomycin |
Notes: | EGFP reporter. Used to monitor transcription on cis-regulatory elements.
This plasmid has been discontinued by Clontech. For an alternative plasmid, try http://www.addgene.org/21280/ . |
Catalog Number: | discontinued |
Stable: | Stable |
Constitutive: | Minimal or No Promoter |
Viral/Non-Viral: | Nonviral |