Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pEGFP-1
| Source/Vendor: | Clontech |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Promotor: | none |
| Cloning Method: | Unknown |
| Size: | 4200 |
| 5' Sequencing 1 Primer: | EGFP-N |
| 5' Sequencing 1 Primer Sequence: | 5'd[CGTCGCCGTCCAGCTCGACCAG]3' |
| Bacterial Resistance: | Kanamycin |
| Selectable Marker: | Neomycin |
| Notes: | EGFP reporter. Used to monitor transcription on cis-regulatory elements.
This plasmid has been discontinued by Clontech. For an alternative plasmid, try http://www.addgene.org/21280/ . |
| Catalog Number: | discontinued |
| Stable: | Stable |
| Constitutive: | Minimal or No Promoter |
| Viral/Non-Viral: | Nonviral |