Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pEGFP-C1

Source/Vendor: Clontech
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Clone Method: Unknown
Size: 4700
5' Sequencing 1 Primer: EGFP-C
5' Sequencing 1 Primer Sequence: 5'd[CATGGTCCTGCTGGAGTTCGTG]
Tag 1: EGFP (Nterm)
Bacterial Resistance: Kanamycin
Selectable Marker: Neomycin
This plasmid has been discontinued by Clontech. For alternative plasmids with fluorescent tags, try plasmids from Doug Golenbock's Lab (http://www.addgene.org/browse/article/979/) or plasmids from Vladislav Verkhusha's Lab (http://www.addgene.org/browse/pi/1030/articles/).
Catalog Number: discontinued
Stable: Stable
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map