Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pET-16b
Source/Vendor: | Novagen (EMD Millipore) |
Alt Name: | pET16b |
Analyze: | Sequence |
Plasmid Type: | Bacterial Expression |
Promotor: | AmpR, lac1 |
Expression Level: | High |
Cloning Method: | Unknown |
Size: | 5711 |
5' Sequencing 1 Primer: | T7 Fwd |
5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3' |
Tag 1: | 10xHis (Nterm) |
Bacterial Resistance: | Ampicillin |
Notes: | Nterm Factor Xa cleavage site
Bacterial vector for expressing 10xHis-tagged proteins. |
Catalog Number: | 69662-3 |
Stable: | Transient |
Constitutive: | Constitutive |
Viral/Non-Viral: | Nonviral |