Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET-24 c (+)
Information
- Source/Vendor
- EMD Biosciences
- Plasmid Type
- Bacterial Expression
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5308
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- T7 (Nterm), His (Cterm)
- Bacterial Resistance
- Kanamycin
- Notes
- Same as pET21abcd(+) but kanR; a,b,c,d vary by MCS; The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand.
- Catalog Number
- 69751-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral