1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pET-28 a (+)

Source/Vendor: EMD Biosciences
Alt Name: pET28a
Analyze: Sequence
Plasmid Type: Bacterial Expression
Expression Level: High
Clone Method: Unknown
Size: 5369
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Tag 1: His (Nterm and Cterm)
Bacterial Resistance: Kanamycin
Notes:
Nterm thrombin cleavage site; a,b,c vary by MCS;
Catalog Number: 69864-3
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map