1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pFLAG-CMV-3

Source/Vendor: Sigma
Alt Name: pFLAG-CMV3, pFLAGCMV3, pFLAG-CMV™-3
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Clone Method: Restriction Enzyme
Size: 6331
5' Sequencing 1 Primer: CMV-F
5' Sequencing 1 Primer Sequence: CGCAAATGGGCGGTAGGCGTG
5' Sequencing 2 Primer: hGH-pA-R
5' Sequencing 2 Primer Sequence: CCAGCTTGGTTCCCAATAGA
Tag 1: FLAG (N terminal)
Bacterial Resistance: Ampicillin
Selectable Marker: Neomycin
Notes:
shuttle vector for transient or stable expression of N-terminal FLAG
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map