Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pFLAG-CMV-4

Source/Vendor: Sigma
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Cloning Method: Restriction Enzyme
Size: 6271
5' Sequencing 1 Primer: CMV-F
5' Sequencing 1 Primer Sequence: CGCAAATGGGCGGTAGGCGTG
5' Sequencing 2 Primer: hGH-pA-R
5' Sequencing 2 Primer Sequence: CCAGCTTGGTTCCCAATAGA
5' Terminal: N-Term
Tag 1: FLAG (N terminal)
Bacterial Resistance: Ampicillin
Selectable Marker: Neomycin
shuttle vector for intracellular transient or stable expression of N-terminal Met-FLAG
Catalog Number: E7158
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map
