Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
Plasmid: pFLD
This page is informational only.
Please contact the manufacturer for further details.
Source/Vendor: | Invitrogen |
Analyze: | Sequence |
Plasmid Type: | Other, Pichia pastoris |
Induced by: | Methylamine |
Promotor: | P-FLD1 |
Cloning Method: | Unknown |
Size: | 4400 |
5' Sequencing 1 Primer: | 3'AOX1 |
5' Sequencing 1 Primer Sequence: | 5'd[GCAAATGGCATTCTGACATCC]3' |
Tag 1: | V5 (Cterm), His (Cterm) |
Bacterial Resistance: | Ampicillin |
Selectable Marker: | Zeocin |
Notes: | Methylamine-inducible expression in Pichia pastoris |
Catalog Number: | V23020 |
Stable: | Stable |
Constitutive: | Inducible |
Viral/Non-Viral: | Nonviral |