Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pFLD

This vector is NOT available from Addgene.

This page is informational only.

Please contact the manufacturer for further details.

Source/Vendor: Invitrogen
Analyze: Sequence
Plasmid Type: Other, Pichia pastoris
Induced by: Methylamine
Promotor: P-FLD1
Cloning Method: Unknown
Size: 4400
5' Sequencing 1 Primer: 3'AOX1
5' Sequencing 1 Primer Sequence: 5'd[GCAAATGGCATTCTGACATCC]3'
Tag 1: V5 (Cterm), His (Cterm)
Bacterial Resistance: Ampicillin
Selectable Marker: Zeocin
Methylamine-inducible expression in Pichia pastoris
Catalog Number: V23020
Stable: Stable
Constitutive: Inducible
Viral/Non-Viral: Nonviral

Generated Plasmid Map
