Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more


Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pGEX-4T1

This vector is NOT available from Addgene.

This page is informational only.

Please contact the manufacturer for further details.

Source/Vendor: Amersham
Alt Name: pGEX-4T-1
Analyze: Sequence
Plasmid Type: Bacterial Expression
Promotor: tac
Cloning Method: Unknown
Size: 4969
5' Sequencing 1 Primer: pGEX5'
5' Sequencing 1 Primer Sequence: GGGCTGGCAAGCCACGTTTGGTG
Tag 1: GST (Nterm)
Tag 2: thrombin site
Bacterial Resistance: Ampicillin
Notes:
thrombin or factor Xa protease sites to cleave protein from fusion. pGEX-1lambdaT, pGEX-4T-1, pGEX-5X-1 accept cDNA from lambda gt11 libs. Hosts: E.coli. Related vectors: pGEX-2T. (Information source: <a href=http://seq.yeastgenome.org/vectordb target=_blank>VectorDB</a>.)
Catalog Number: 27458001
GenBank: M21676, M97937
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Nonviral

Generated Plasmid Map

Loading...