1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pGEX-4T3

Source/Vendor: GE Healthcare Life Sciences
Alt Name: pGEX-4T-3
Analyze: Sequence
Plasmid Type: Bacterial Expression
Promotor: tac
Clone Method: Unknown
Size: 4968
5' Sequencing 1 Primer: pGEX5'
5' Sequencing 1 Primer Sequence: GGGCTGGCAAGCCACGTTTGGTG
Tag 1: GST
Tag 2: thrombin site
Bacterial Resistance: Ampicillin
Notes:
thrombin or factor Xa protease sites to cleave protein from fusion. pGEX-1lambdaT, pGEX-4T-1, pGEX-5X-1 accept cDNA from lambda gt11 libs. Hosts: E.coli. Related vectors: pGEX-2T. (Information source: <a href=http://seq.yeastgenome.org/vectordb target=_blank>VectorDB</a>.)
Catalog Number: 27458301
GenBank: M21676, M97937
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map