Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pGL3-Promoter
Source/Vendor: | Promega |
Analyze: | Sequence |
Plasmid Type: | Luciferase |
Promotor: | SV40 |
Cloning Method: | Unknown |
Size: | 5010 |
5' Sequencing 1 Primer: | RVprimer3 |
5' Sequencing 1 Primer Sequence: | CTAGCAAAATAGGCTGTCCC |
Bacterial Resistance: | Ampicillin |
Notes: | Luciferase reporter vector. For mor information, see http://www.promega.com/vectors/cloning_vectors.htm#b05.
SV40 promoter-containing vector for measuring the activity of enhancer sequences with a luciferase assay.
|
Catalog Number: | E1761 |
GenBank: | U47298 |
Stable: | Unspecified |
Constitutive: | Unspecified |
Viral/Non-Viral: | Nonviral |