Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pGL3-Promoter

Source/Vendor: Promega
Analyze: Sequence
Plasmid Type: Luciferase
Promotor: SV40
Cloning Method: Unknown
Size: 5010
5' Sequencing 1 Primer: RVprimer3
5' Sequencing 1 Primer Sequence: CTAGCAAAATAGGCTGTCCC
Bacterial Resistance: Ampicillin
Notes:
Luciferase reporter vector. For mor information, see http://www.promega.com/vectors/cloning_vectors.htm#b05. SV40 promoter-containing vector for measuring the activity of enhancer sequences with a luciferase assay.
Catalog Number: E1761
GenBank: U47298
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Nonviral

Generated Plasmid Map

Loading...
Analyze Sequence