1
Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pHAT20

Source/Vendor: Clontech
Analyze: Sequence
Plasmid Type: Bacterial Expression
Promotor: lac
Clone Method: Unknown
Size: 2800
5' Sequencing 1 Primer: HAT
5' Sequencing 1 Primer Sequence: 5'd[GAGGAGCACGCTCATGCCCAC]3'
Tag 1: HAT (Nterm)
Bacterial Resistance: Ampicillin
Notes:
Histidine Affinity Tag (HAT) for purification
Catalog Number: 631202
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map