Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pLEGFP-C1

This vector is NOT available from Addgene.

This page is informational only.

Please contact the manufacturer for further details.

Source/Vendor: Clontech
Plasmid Type: Mammalian Expression
Promotor: CMV
Cloning Method: Unknown
Size: 6900
5' Sequencing 1 Primer: EGFP-C
5' Sequencing 1 Primer Sequence: 5'd[CATGGTCCTGCTGGAGTTCGTG]3'
Tag 1: EGFP (Nterm)
Bacterial Resistance: Ampicillin
Selectable Marker: Neomycin
Notes:
Retrovial expression of GFP fusions
Catalog Number: 6058-1
Stable: Stable
Constitutive: Constitutive
Viral/Non-Viral: Retroviral