Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pmCherry-C1
Source/Vendor: | Clontech |
Analyze: | Sequence |
Plasmid Type: | Mammalian Expression |
Promotor: | CMV |
Cloning Method: | Unknown |
Size: | 4722 |
5' Sequencing 1 Primer: | SV40pA-R |
5' Sequencing 1 Primer Sequence: | GAAATTTGTGATGCTATTGC |
Tag 1: | mCherry |
Bacterial Resistance: | Kanamycin |
Selectable Marker: | Neomycin |
Catalog Number: | 632524 |
Stable: | Transient |
Constitutive: | Constitutive |
Viral/Non-Viral: | Nonviral |