Plasmid: pMIB/V5-His B
| Source/Vendor: | Invitrogen |
|---|---|
| Analyze: | Sequence |
| Plasmid Type: | Other |
| Promotor: | OpIE2 |
| Clone Method: | Unknown |
| Size: | 3600 |
| 5' Sequencing 1 Primer: | OpIE2 |
| 5' Sequencing 1 Primer Sequence: | 5'd[CGCAACGATCTGGTAAACAC]3' |
| Tag 1: | HBM (N), V5 (C), His (C) |
| Bacterial Resistance: | Ampicillin |
| Selectable Marker: | Blasticidin |
| Notes: | Stable expression of gene in insect cells. HBM tag causes protein to be secreted. |
| Catalog Number: | V803001 |
| Stable: | Stable |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |