Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pMXs-GW
| Alt Name: | pMXs-Gateway |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression, Retroviral |
| Cloning Method: | Unknown |
| 5' Sequencing 1 Primer: | 5': pBMN5'; 3': pMX-AS3200 |
| 5' Sequencing 1 Primer Sequence: | pMX-AS3200: TTATCGTCGACCACTGTGCTGCTG |
| Bacterial Resistance: | Ampicillin |
| Notes: | Note: Sequence map below is missing the Gateway cassette between bp 1938-2013.
Sequence provided by Dr. Kazutoshi Takahashi and Dr. Shinya Yamanaka. |
| Stable: | Unspecified |
| Constitutive: | Unspecified |
| Viral/Non-Viral: | Retroviral |