Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pTRE2hyg2-HA
| Source/Vendor: | Clontech |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Induced by: | Tetracycline |
| Promotor: | Tet-responsive |
| Cloning Method: | Unknown |
| Size: | 5400 |
| 5' Sequencing 1 Primer: | HA |
| 5' Sequencing 1 Primer Sequence: | 5'd[ATGTACCCATACCATGTTCCAGATTAC]3' |
| Tag 1: | HA (Nterm) |
| Bacterial Resistance: | Ampicillin |
| Selectable Marker: | Hygromycin |
| Notes: | Express HA-tagged gene under tet-responsive promoter. Selectable with hygromycin |
| Catalog Number: | 631051 |
| Stable: | Stable |
| Constitutive: | Inducible |
| Viral/Non-Viral: | Nonviral |