1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pTRE2pur-HA

Source/Vendor: Clontech
Analyze: Sequence
Plasmid Type: Mammalian Expression
Induced by: Tetracycline
Promotor: Tet-responsive
Clone Method: Unknown
Size: 5200
5' Sequencing 1 Primer: HA
5' Sequencing 1 Primer Sequence: 5'd[ATGTACCCATACCATGTTCCAGATTAC]3'
Tag 1: HA (Nterm)
Bacterial Resistance: Ampicillin
Selectable Marker: Puromycin
Notes:
Express HA-tagged gene under tet-responsive promoter. Selectable with puromycin
Catalog Number: 631054
Stable: Stable
Constitutive: Inducible
Viral/Non-Viral: Nonviral

Generated Plasmid Map