Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pTRE2pur-Myc

Source/Vendor: Clontech
Analyze: Sequence
Plasmid Type: Mammalian Expression
Induced by: Tetracycline
Promotor: Tet-responsive
Cloning Method: Unknown
Size: 5200
5' Sequencing 1 Primer: Myc
5' Sequencing 1 Primer Sequence: 5'd[GCATCAATGCAGAAGCTGATCTCA]3'
Tag 1: Myc (Nterm)
Bacterial Resistance: Ampicillin
Selectable Marker: Puromycin
Express Myc-tagged gene under tet-responsive promoter. Selectable with puromycin
Catalog Number: 6261-1
Stable: Stable
Constitutive: Inducible
Viral/Non-Viral: Nonviral

Generated Plasmid Map
