1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pTriEx-4

Source/Vendor: Novagen
Analyze: Sequence
Plasmid Type: Mammalian Expression,
Clone Method: Unknown
Size: 5238
5' Sequencing 1 Primer: TriExDOWN
5' Sequencing 1 Primer Sequence: TCGATCTCAGTGGTATTTGTG
Bacterial Resistance: Ampicillin
Catalog Number: EMD 70824
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map