1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: pYES2/NT B

Source/Vendor: Invitrogen
Analyze: Sequence
Plasmid Type: Yeast Expression, Saccharomyces cerevisiae
Induced by: Galactose
Promotor: P-GAL1
Clone Method: Unknown
Size: 6000
5' Sequencing 1 Primer: GAL1
5' Sequencing 1 Primer Sequence: 5'd[AATATACCTCTATACTTTAACGTC]3'
Tag 1: His (N&C), Xpress (N), V5 (C)
Bacterial Resistance: Ampicillin
Selectable Marker: URA3
Notes:
Tagged expression in S. cerevisiae
Catalog Number: V825120
Stable: Unspecified
Constitutive: Inducible
Viral/Non-Viral: Nonviral

Generated Plasmid Map