1

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.


Plasmid: TREx pcDNA5/TO

Source/Vendor: Invitrogen
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Clone Method: Unknown
5' Sequencing 1 Primer: CMVPro Fwd
5' Sequencing 1 Primer Sequence: 5'd[CGCAAATGGGCGGTAGGCGTG]3'
Bacterial Resistance: Ampicillin
Selectable Marker: Hygromycin
GenBank:
Stable: Transient
Constitutive: Inducible
Viral/Non-Viral: Nonviral