Skip to main content
Addgene
Open Menu

pCAG-c-Myc NLS-FKBP-Venus N-T2A-mRFP
(Plasmid #100979)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100979 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 100979-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 100979-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG IRES Blasticidin
  • Backbone size w/o insert (bp) 6228
  • Total vector size (bp) 7877
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    c-Myc NLS-FKBP-Venus N-T2A-mRFP
  • Species
    Synthetic
  • Insert Size (bp)
    1649
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TGGGCAACGTGCTGGTTATTG
  • 3′ sequencing primer ATTCCAAGCGGCTTCGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-c-Myc NLS-FKBP-Venus N-T2A-mRFP was a gift from Heinrich Leonhardt (Addgene plasmid # 100979 ; http://n2t.net/addgene:100979 ; RRID:Addgene_100979)

  • For your References section:

    Nanoparticle Mediated Delivery and Small Molecule Triggered Activation of Proteins in the Nucleus. Chiu HY, Bates JA, Helma J, Engelke H, Harz H, Bein T, Leonhardt H. Nucleus. 2018 Sep 14. doi: 10.1080/19491034.2018.1523665. 10.1080/19491034.2018.1523665 PubMed 30217128
Related items:
Commonly requested with: