pET28a His tag-FRB-Venus C
(Plasmid
#100980)
-
PurposeEncodes half of a protein delivery sensor (His-FRB-Venus C) for expression in and purification from Bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET 28a
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5201
- Total vector size (bp) 5833
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHis-FRB-Venus C
-
SpeciesSynthetic
-
Insert Size (bp)632
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ctttgttagcagccggatctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a His tag-FRB-Venus C was a gift from Heinrich Leonhardt (Addgene plasmid # 100980 ; http://n2t.net/addgene:100980 ; RRID:Addgene_100980) -
For your References section:
Nanoparticle Mediated Delivery and Small Molecule Triggered Activation of Proteins in the Nucleus. Chiu HY, Bates JA, Helma J, Engelke H, Harz H, Bein T, Leonhardt H. Nucleus. 2018 Sep 14. doi: 10.1080/19491034.2018.1523665. 10.1080/19491034.2018.1523665 PubMed 30217128