pEGFP-NMHC-IIA-3xA
(Plasmid
#101041)
-
PurposeExpresses GFP-MYH9 construct (human myosin IIA) carrying S1943A mutation and S1916A, S1915A mutation, driven by CMV promoter. Thus inhibits CKII and PKC phosphorylation of the tail.
-
Depositing Lab
-
Depositing OrganizationCleveland Clinic Foundation
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 101041-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 101041-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerclonetech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNon-muscle myosin IIA heavy chain
-
Alt nameMYH9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5883
-
MutationS1915A, S1916A, S1943A
-
Entrez GeneMYH9 (a.k.a. BDPLT6, DFNA17, EPSTS, FTNS, MATINS, MHA, NMHC-II-A, NMMHC-IIA, NMMHCA)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site Sal (unknown if destroyed)
- 5′ sequencing primer GGAGTTCGTGACCGCCGCCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Robert Adelstein, NIHLB, NIH
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 101041-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 101041-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-NMHC-IIA-3xA was a gift from Tom Egelhoff (Addgene plasmid # 101041 ; http://n2t.net/addgene:101041 ; RRID:Addgene_101041) -
For your References section:
Myosin IIA Heavy Chain Phosphorylation Mediates Adhesion Maturation and Protrusion in Three Dimensions. Rai V, Thomas DG, Beach JR, Egelhoff TT. J Biol Chem. 2017 Feb 24;292(8):3099-3111. doi: 10.1074/jbc.M116.733402. Epub 2017 Jan 4. 10.1074/jbc.M116.733402 PubMed 28053086