pCZGY3163
(Plasmid
#101248)
-
PurposeGFP11::rps-18, ribosomal protein subunit, bound to C-terminal part of GFP. Shows GFP localized to ribosomes when combined with GFP 1-10.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 101248-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 101248-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCR8 Gateway Entry Vector
- Backbone size w/o insert (bp) 3545
- Total vector size (bp) 4320
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegfp11::rps-18
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)775
-
Entrez Generps-18 (a.k.a. CELE_Y57G11C.16)
-
Tag
/ Fusion Protein
- GFP11
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer ccctctactcaatttcagcaaaaa
- 3′ sequencing primer tctttaataatgtttgcctcgatc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When using this clone for publication, please reference:
Noma K, Goncharov A, Ellisman MH, Jin Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
DNA (Catalog # 101248-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 101248-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY3163 was a gift from Yishi Jin (Addgene plasmid # 101248 ; http://n2t.net/addgene:101248 ; RRID:Addgene_101248) -
For your References section:
Microtubule-dependent ribosome localization in C. elegans neurons. Noma K, Goncharov A, Ellisman MH, Jin Y. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. 10.7554/eLife.26376 PubMed 28767038