EphA2 430-976 pcDNA3.1
(Plasmid
#102738)
-
PurposeExpression of c terminal EphA2 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationVanderbilt University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102738 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 102738-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 102738-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEphA2 N terminal (430-976aa)
-
Alt nameEck
-
SpeciesM. musculus (mouse)
-
Entrez GeneEpha2 (a.k.a. AW545284, Eck, Myk2, Sek-2, Sek2)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer ACTGCACTCGAGGATAGGAATCCCCACTGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 102738-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 102738-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EphA2 430-976 pcDNA3.1 was a gift from Jin Chen (Addgene plasmid # 102738 ; http://n2t.net/addgene:102738 ; RRID:Addgene_102738) -
For your References section:
EPHA2 Blockade Overcomes Acquired Resistance to EGFR Kinase Inhibitors in Lung Cancer. Amato KR, Wang S, Tan L, Hastings AK, Song W, Lovly CM, Meador CB, Ye F, Lu P, Balko JM, Colvin DC, Cates JM, Pao W, Gray NS, Chen J. Cancer Res. 2016 Jan 15;76(2):305-18. doi: 10.1158/0008-5472.CAN-15-0717. Epub 2016 Jan 7. 10.1158/0008-5472.CAN-15-0717 PubMed 26744526