Skip to main content

EphA2 430-976 pcDNA3.1
(Plasmid #102738)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102738 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 102738-D50 50 μg of DNA in Tris buffer $495
DNA 102738-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EphA2 N terminal (430-976aa)
  • Alt name
    Eck
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Epha2 (a.k.a. AW545284, Eck, Myk2, Sek-2, Sek2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer ACTGCACTCGAGGATAGGAATCCCCACTGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EphA2 430-976 pcDNA3.1 was a gift from Jin Chen (Addgene plasmid # 102738 ; http://n2t.net/addgene:102738 ; RRID:Addgene_102738)
  • For your References section:

    EPHA2 Blockade Overcomes Acquired Resistance to EGFR Kinase Inhibitors in Lung Cancer. Amato KR, Wang S, Tan L, Hastings AK, Song W, Lovly CM, Meador CB, Ye F, Lu P, Balko JM, Colvin DC, Cates JM, Pao W, Gray NS, Chen J. Cancer Res. 2016 Jan 15;76(2):305-18. doi: 10.1158/0008-5472.CAN-15-0717. Epub 2016 Jan 7. 10.1158/0008-5472.CAN-15-0717 PubMed 26744526