STAGR_SAMScaffold_hH1
(Plasmid
#102847)
-
PurposeCan be used as PCR template for a STAgR reaction
-
Depositing Lab
-
Depositing OrganizationLudwig-Maximilians-Universitaet Muenchen (LMU)
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102847 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 102847-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 102847-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePCR Template for STAgR Reactions
-
Backbone manufacturerStricker Lab
-
Vector typePCR Template for STAgR Inserts
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSTAgR Insert SAM_hH1
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTGGATCCGGTACCAAGG
- 3′ sequencing primer TTACGGTTCCTGGCCTTTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 102847-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 102847-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
STAGR_SAMScaffold_hH1 was a gift from Stefan Stricker (Addgene plasmid # 102847 ; http://n2t.net/addgene:102847 ; RRID:Addgene_102847) -
For your References section:
One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR). Breunig CT, Durovic T, Neuner AM, Baumann V, Wiesbeck MF, Koferle A, Gotz M, Ninkovic J, Stricker SH. PLoS One. 2018 Apr 27;13(4):e0196015. doi: 10.1371/journal.pone.0196015. eCollection 2018. 10.1371/journal.pone.0196015 PubMed 29702666