Skip to main content

myc-hIFITM3-delta59-68
(Plasmid #104361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104361 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 104361-D50 50 μg of DNA in Tris buffer $495
DNA 104361-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-myc
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4172
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFITM3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    372
  • Mutation
    deleted amino acids 59 through 68
  • Entrez Gene
    IFITM3 (a.k.a. 1-8U, DSPA2b, IP15)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Sal1 (not destroyed)
  • 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    myc-hIFITM3-delta59-68 was a gift from Jacob Yount (Addgene plasmid # 104361 ; http://n2t.net/addgene:104361 ; RRID:Addgene_104361)
  • For your References section:

    IFITM3 requires an amphipathic helix for antiviral activity. Chesarino NM, Compton AA, McMichael TM, Kenney AD, Zhang L, Soewarna V, Davis M, Schwartz O, Yount JS. EMBO Rep. 2017 Oct;18(10):1740-1751. doi: 10.15252/embr.201744100. Epub 2017 Aug 23. 10.15252/embr.201744100 PubMed 28835547