Skip to main content

SLC39A14-GFP
(Plasmid #104380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104380 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 104380-D50 50 μg of DNA in Tris buffer $495
DNA 104380-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLC39A14
  • Alt name
    ZIP14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Entrez Gene
    SLC39A14 (a.k.a. HMNDYT2, LZT-Hs4, NET34, ZIP14, cig19)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GTC GGT ACC ATG AAG CTG CTG CTG CTG CAC
  • 3′ sequencing primer CGCGGATCCCCCAATCTGGATCTGTCCTGAATA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SLC39A14-GFP was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 104380 ; http://n2t.net/addgene:104380 ; RRID:Addgene_104380)
  • For your References section:

    Hypothyroidism induced by loss of the manganese efflux transporter SLC30A10 may be explained by reduced thyroxine production. Liu C, Hutchens S, Jursa T, Shawlot W, Polishchuk EV, Polishchuk RS, Dray BK, Gore AC, Aschner M, Smith DR, Mukhopadhyay S. J Biol Chem. 2017 Oct 6;292(40):16605-16615. doi: 10.1074/jbc.M117.804989. Epub 2017 Aug 31. 10.1074/jbc.M117.804989 PubMed 28860195