pSpCas9 (BB)-2A-GFP gamma-tubulin sg
(Plasmid
#104437)
-
PurposeKnockdown the expression of gamma-tubulin in human cells
-
Depositing Lab
-
Depositing OrganizationLund University
Located in Sweden -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 104437-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 104437-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSpCas9 (BB)-2A-GFP
-
Backbone manufacturerDr. Zhang
- Backbone size w/o insert (bp) 9289
- Total vector size (bp) 9309
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegamma-tubulin sgRNA
-
Alt nameNA
-
gRNA/shRNA sequenceTACAGTTGGGCCAGTGCGGC
-
SpeciesH. sapiens (human)
-
GenBank ID
-
Tag
/ Fusion Protein
- The gamma-tubulin sgRNA is coexpressed with 3xFLAG-Cas9-GFP
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was a gift from Dr. Zhang
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 104437-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 104437-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9 (BB)-2A-GFP gamma-tubulin sg was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104437 ; http://n2t.net/addgene:104437 ; RRID:Addgene_104437) -
For your References section:
Characterization of gamma-tubulin filaments in mammalian cells. Lindstrom L, Alvarado-Kristensson M. Biochim Biophys Acta. 2017 Oct 16. pii: S0167-4889(17)30283-5. doi: 10.1016/j.bbamcr.2017.10.008. 10.1016/j.bbamcr.2017.10.008 PubMed 29050966