pSC49
(Plasmid
#104823)
-
PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma17g11235 (Dcl4a). Also expresses Cas9 from AtUBQ10 promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSC218
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGlyma17g11235
-
Alt nameDcl4a
-
gRNA/shRNA sequenceatgtggttgaagctctggt, tgattggagacgcttaagga
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
112-151:1.1. Alternative name of plasmid: pSG218UG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC49 was a gift from Robert Stupar (Addgene plasmid # 104823 ; http://n2t.net/addgene:104823 ; RRID:Addgene_104823)