Skip to main content
Addgene
Open Menu

pmKikGR Actin
(Plasmid #105315)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105315 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 105315-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 105315-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pmKikGRNB
  • Backbone manufacturer
    modified pEGFP-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    actin beta
  • Alt name
    ACTB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1100
  • Entrez Gene
    ACTB (a.k.a. BKRNS, BNS, BRWS1, CSMH, DDS1, PS1TP5BP1, THC8)
  • Tag / Fusion Protein
    • KikGR (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site Xba1 (unknown if destroyed)
  • 5′ sequencing primer TCCAGTTGCCAGACTATCAC
  • 3′ sequencing primer ATGTTTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pmKikGR was constructed by inserting sequence corresponding to mKikGR with Kozak sequence to replace EGFP in Nhe1 /BglII sites of pEGFP NBC1. mKikGR was from Dr. Atsushi Miyawaki (Riken BSI).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmKikGR Actin was a gift from Kenneth Yamada (Addgene plasmid # 105315 ; http://n2t.net/addgene:105315 ; RRID:Addgene_105315)

  • For your References section:

    Micro-environmental control of cell migration--myosin IIA is required for efficient migration in fibrillar environments through control of cell adhesion dynamics. Doyle AD, Kutys ML, Conti MA, Matsumoto K, Adelstein RS, Yamada KM. J Cell Sci. 2012 May 1;125(Pt 9):2244-56. doi: 10.1242/jcs.098806. Epub 2012 Feb 10. 10.1242/jcs.098806 PubMed 22328520
Related items:
Commonly requested with: